Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera

Abstract

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati

Traditional Indonesian fermented foods have been studied as potential probiotics, for example dadiah from West Sumatera are made by fermenting buffalo milk in bamboo tubes. But the potential of halal probiotics isolated from Air Dingin District, West Sumatra (Indonesia) has not been studied. The purpose of this study was to determine the potential of halal probiotic lactic acid bacteria (LAB) Lactobacillus plantarum strain 8m-21 isolation from dadiah in Air Dingin Alahan Panjang District, Solok Regency West Sumatera (Indonesia) against to pathogenic bacteria and antimicrobial activity. Previously lactic acid bacteria Lactobacillus plantarum had been isolationand molecular identification used I6S rRNA with Forward (27F AGAGTTTGATCCTGGCTGAG) and Reverse primer (1492R; GTTTACCTTACGACTT). In this study we analyzed the probiotics have antimicrobial activity against pathogenic bacteria Escherichia coli O157. The results showed that Lactobacillus plantarum strain 8m-21 from Air Dingin dadiah isolates have probiotic properties because they have antimicrobial properties which able to inhibit Escherichia coli, aerob (pathogenic) bacteria and have highest antimicrobial with 20.25 mm inhibition than other sintetic antibiotics.

Most Viewed Articles
  • Dental Development between Assisted Reproductive Therapy (Art) and Natural Conceived Children: A Comparative Pilot Study Norzaiti Mohd Kenali, Naimah Hasanah Mohd Fathil, Norbasyirah Bohari, Ahmad Faisal Ismail, Roszaman Ramli SRP. 2020; 11(1): 01-06 » doi: 10.5530/srp.2020.1.01
  • Psychometric properties of the World Health Organization Quality of life instrument, short form: Validity in the Vietnamese healthcare context Trung Quang Vo*, Bao Tran Thuy Tran, Ngan Thuy Nguyen, Tram ThiHuyen Nguyen, Thuy Phan Chung Tran SRP. 2020; 11(1): 14-22 » doi: 10.5530/srp.2019.1.3
  • A Review of Pharmacoeconomics: the key to “Healthcare for All” Hasamnis AA, Patil SS, Shaik Imam, Narendiran K SRP. 2019; 10(1): s40-s42 » doi: 10.5530/srp.2019.1s.21
  • Deuterium Depleted Water as an Adjuvant in Treatment of Cancer Anton Syroeshkin, Olga Levitskaya, Elena Uspenskaya, Tatiana Pleteneva, Daria Romaykina, Daria Ermakova SRP. 2019; 10(1): 112-117 » doi: 10.5530/srp.2019.1.19
Most Downloaded
  • Dental Development between Assisted Reproductive Therapy (Art) and Natural Conceived Children: A Comparative Pilot Study Norzaiti Mohd Kenali, Naimah Hasanah Mohd Fathil, Norbasyirah Bohari, Ahmad Faisal Ismail, Roszaman Ramli SRP. 2020; 11(1): 01-06 » doi: 10.5530/srp.2020.1.01
  • Manilkara zapota (L.) Royen Fruit Peel: A Phytochemical and Pharmacological Review Karle Pravin P, Dhawale Shashikant C SRP. 2019; 10(1): 11-14 » doi: 0.5530/srp.2019.1.2
  • Pharmacognostic and Phytopharmacological Overview on Bombax ceiba Pankaj Haribhau Chaudhary, Mukund Ganeshrao Tawar SRP. 2019; 10(1): 20-25 » doi: 10.5530/srp.2019.1.4
  • A Review of Pharmacoeconomics: the key to “Healthcare for All” Hasamnis AA, Patil SS, Shaik Imam, Narendiran K SRP. 2019; 10(1): s40-s42 » doi: 10.5530/srp.2019.1s.21
  • A Prospective Review on Phyto-Pharmacological Aspects of Andrographis paniculata Govindraj Akilandeswari, Arumugam Vijaya Anand, Palanisamy Sampathkumar, Puthamohan Vinayaga Moorthi, Basavaraju Preethi SRP. 2019; 10(1): 15-19 » doi: 10.5530/srp.2019.1.3